Tin mới

Đông trùng hạ thảo

Liên hệ

Mua

Mô tả

NUÔI CẤY THÀNH CÔNG NẤM NHỘNG TRÙNG THẢO (Cordyceps militaris (L.: Fr.) Link.) HƯỚNG ĐẾN CHUYỂN GIAO, NHÂN RỘNG GÓP

PHẦN PHÁT TRIỂN KINH TẾ-XÃ HỘI ĐỊA PHƯƠNG

 

Nguyễn Như Chương1, Phan Quốc Chính1, Trần Thị Mỹ Linh1, Thái Thị Thanh Thủy1, Hoàng Hà2

 

1. Trung tâm Ứng dụng khoa học và công nghệ, Sở Khoa học và Công nghệ Lâm Đồng 2. Viện Công nghệ sinh học

 

1. MỞ ĐẦU

Đông trùng hạ thảo được gọi là “Dong Chong Xia Cao” theo tiếng Trung Quốc, “Dong Chung Ha Cao” theo tiếng Hàn Quốc “Winter Worm Summer Grass” theo tiếng Anh, là một dạng ký sinh đặc biệt giữa loài nấm túi Cordyceps sinensis (Berk.) Sacc. và ấu trùng (sâu non) của một số loài côn trùng thuộc chi  Hepialus, thường gặp là sâu non của loài Hepialus armoricanus Oberthur. Thông thường trong tự nhiên Đông trùng hạ thảo chỉ được tìm thấy vào mùa hè ở các khu vực cao hơn mặt nước biển khoảng 3.500 – 5.000m tại Trung Quốc như: Tây Tạng, Tứ Xuyên, Cam Túc, Vân Nam … Trên thế giới chi Cordyceps có hơn 450 loài khác nhau, là chi lớn nhất trong họ Clavicipitaceae, phân bố trên toàn thế giới, đặc biệt ở những vùng nhiệt đới và cận nhiệt đới như: Đông Nam Á và Đông Á, ngoại trừ Nam cực. [3]

Đông trùng hạ thảo là một loại dược liệu truyền thống quý, được sử dụng hơn 2.000 năm ở Trung Quốc bởi đông trùng hạ thảo chứa các chất có hoạt tính sinh học và dược học phong phú, đa dạng như: adenosine, cordycepin (3’-deoxyadenosine), cordycepic acide (D-mannitol), cyclosporin …; có tác dụng bảo vệ tim mạch, chữa bệnh tim mãn tính, tăng lượng oxy trong máu, làm giảm mỡ máu, đường máu, cholesterol, có khả năng điều hòa miễn dịch, có tác dụng điều hòa đường huyết, chống ung thư, kháng vi khuẩn, nấm, virus … [2]

Loài thứ hai có ý nghĩa dược liệu tương tự Đông trùng hạ thảo là Cordyceps militaris (L.: Fr.) Link.

được gọi là Nhộng trùng thảo, trong tự nhiên loài nấm này thường ký sinh trên nhộng tằm (Bombyx mori) và một số ấu trùng của các côn trùng khác.

Với giá trị dược liệu quý và hiệu quả kinh tế, hiện nay trong nước và trên địa bàn tỉnh Lâm Đồng có một số đơn vị nghiên cứu và cơ sở sản xuất nấm Nhộng trùng thảo; tuy nhiên, chất lượng sản phẩm chưa được công bố rộng rãi, giá bán còn khá cao. Vì vậy, đề tài thực hiện có ý nghĩa quan trọng trong việc xây dựng quy trình nuôi trồng nấm nhộng trùng thảo, phân tích chất lượng sản phẩm, hướng đến chuyển giao, nhân rộng sản xuất đại trà cung cấp nguồn dược liệu quý, góp phần phát triển kinh tế-xã hội địa phương.

2. VẬT LIỆU VÀ PHƯƠNG PHÁP NGHIÊN CỨU

2.1. Vật liệu

Chủng nấm Nhộng trùng thảo nhập nội (ký hiệm Cm) được thu thập, đưa về phòng Công nghệ sinh học của Trung tâm Ứng dụng khoa học và công nghệ, Sở Khoa học và Công nghệ tỉnh Lâm Đồng và lưu giữ, bảo tồn phục vụ nghiên cứu, chuyển giao.

2.2. Phương pháp

2.2.1. Khảo sát một số yếu tố ảnh hưởng đến phát triển hệ sợi nấm

Với môi trường nền PDA, đề tài khảo sát một số yếu tố ảnh hưởng đến phát triển hệ sợi nấm như:

nguồn carbon (glucose, saccharose, maltose); nguồn nitơ hữu cơ (peptone, cao thịt, cao nấm men); pH (6, 7, 8, 9); nhiệt độ (20oC, 22oC, 25oC).

2.2.2. Phân tích ITS-rDNA

Chủng nấm được gửi phân tích ITS-rDNA tại Viện Công nghệ Sinh học, kết quả trình tự được so sánh với trình tự chuẩn trong GenBank bằng công cụ BLAST của NCBI

(http://blast.ncbi.nlm.nih.gov/Blast.cgi).

2.2.3. Nhân giống nấm, nuôi trồng ra quả thể

Giống nấm nguyên chủng được nhân giống trên môi trường thạch nghiêng PDA để lưu giữ, phục vụ các nghiên cứu tiếp theo. Nhân giống dịch thể trên môi trường PD. Nuôi trồng ra quả thể trên môi trường tổng hợp: 90% gạo lức, 10% bột nhộng tằm; môi trường côn trùng: nhộng tằm 99%, 1% bột gạo lứt; hấp tiệt trùng ở 121oC trong 60 phút.

Sau khi cấy giống các môi trường được đưa vào phòng ủ tơ ở nhiệt độ 25 ± 20C, độ ẩm không khí 65 - 70 %, tối, thoáng. Sau khi hệ sợi nấm lan kín bề mặt cơ chất, đưa vào nhà nuôi trồng có nhiệt độ 20 – 24oC, độ ẩm không khí 85 – 90%, ánh sáng 500 – 700 lux.

2.2.4. Phân tích một số thành phần dinh dưỡng và chất có hoạt tính sinh học Gửi mẫu quả thể phân tích tại Viện Thực phẩm chức năng.

2.2.5. Xử lý số liệu

  • Số liệu thu được xử lý theo phương pháp thống kê sinh học (Phạm Văn Tất, 2007), tính toán các thông số được thực hiện bằng chương trình Microsoft Excel 2003, tính toán thống kê ở độ tin cậy 95%.

    [4]

  • Năng suất sinh học (H) được biểu thị bằng % theo công thức:

P1

H x100

P2

Trong đó:

P1 là trọng lượng của quả thể nấm tươi, g

P2 là trọng lượng khô của cơ chất ban đầu, g

 

3. KẾT QUẢ VÀ THẢO LUẬN

3.1. Khảo sát một số yếu tố ảnh hưởng đến phát triển hệ sợi nấm 

Từ chủng nấm Nhộng trùng thảo thuần chủng, hệ sợi nấm tiếp tục được khảo sát một số yếu tố ảnh hưởng đến phát triển hệ sợi nấm trên môi trường nền PDA. Đường kính khuẩn lạc nấm được đo đạc theo thời gian để xác định tốc độ phát triển hệ sợi nấm.

Bảng 1. Tốc độ phát triển hệ sợi nấm trên một số nguồn carbon sau 11 ngày nuôi cấy

 

TT

Nguồn carbon

Tốc độ phát triển hệ sợi trung bình (mm/ngày)

1

Glucose

5,36 ± 0,167

2

Saccharose

5,09 ± 0,164

3

Maltose

4,64 ± 0,167

Qua Bảng 1 và kết quả xử lý thống kê trên một số nguồn carbon sau 11 ngày nuôi cấy cho thấy có sự khác biệt về tốc độ phát triển hệ sợi nấm. Do đó nguồn carbon glucose là thích hợp để nhân giống nấm Cordyceps militaris (kết quả này phù hợp với công bố của Amit K. S. và Anand S., 2006; Ting-chi W. et al., 2014). [1, 5]

                                         

Hình 1. Khuẩn lạc nấm Cordyceps militaris trên môi trường PDA sau 11 ngày nuôi cấy

 

Bảng 2. Tốc độ phát triển hệ sợi nấm trên một số nguồn nitơ sau 11 ngày nuôi cấy

 

TT

Nguồn nitơ

Tốc độ phát triển hệ sợi trung bình (mm/ngày)

1

Cao thịt

4,84 ± 0,087

2

Peptone

5,31 ± 0,118

3

Cao nấm men

4,89 ± 0,135

Qua Bảng 2 và kết quả xử lý thống kê trên một số nguồn nitơ sau 11 ngày nuôi cấy cho thấy có sự khác biệt về tốc độ phát triển hệ sợi nấm. Do đó nguồn nitơ hữu cơ peptone là thích hợp để nhân giống nấm Cordyceps militaris (kết quả này phù hợp với công bố của Amit K. S. và Anand S., 2006; Ting-chi W. et al., 2014). [1, 5]

Bảng 3. Tốc độ phát triển hệ sợi nấm ở một số ngưỡng nhiệt độ sau 11 ngày nuôi cấy

 

TT

Nhiệt độ, oC

Tốc độ phát triển hệ sợi trung bình (mm/ngày)

1

20

5,18 ± 0,164

2

22

5,27 ± 0,073

3

25

5,38 ± 0,139

Qua Bảng 3 và kết quả xử lý thống kê ở một số  ngưỡng nhiệt độ sau 11 ngày nuôi cấy cho thấy không có sự khác biệt về tốc độ phát triển hệ sợi nấm. Do đó khoảng nhiệt độ 20 – 25oC là thích hợp để nhân giống nấm Cordyceps militaris (kết quả này phù hợp với công bố của Amit K. S. và Anand S., 2006). [1]

Bảng 4. Tốc độ phát triển hệ sợi nấm ở một số ngưỡng pH sau 11 ngày nuôi cấy

 

TT

pH

Tốc độ phát triển hệ sợi trung bình (mm/ngày)

1

6

5,43 ± 0,091

2

7

5,07 ± 0,087

3

8

4,78 ± 0,118

4

9

4,62 ± 0,139

Qua Bảng 4 và kết quả xử lý thống kê ở một số ngưỡng pH sau 11 ngày nuôi cấy cho thấy có sự khác biệt về tốc độ phát triển hệ sợi nấm. Do đó pH = 6,0 là thích hợp để nhân giống nấm Cordyceps militaris (kết quả này phù hợp với công bố của Ting-chi W. et al., 2014). [5]

3.2. Kết quả giám định ITS-rDNA

Trình tự ITS1-ITS4 rDNA của chủng nấm Nhộng trùng thảo được xác định:

 

AGGTGAACCTGCGGAGGGATCATTAACGAGTTTTCCAACTCCCAACCCTTTGTGAAA

TACCTATCGTTGCTTCGGCGGACTCGCCCAGCGCCTGGACGCGGGCCTGGGCGGCGGCCGTCGGGGGCCCCAAACACTGTATCTACCAGTTTTTCTGAATCCGCCGCAAGGCAAAACAAATGAATCAAAACTTTCAACAACGGATCTCTTGGCTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGC


CAGCATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCGACGTCCCCTGGGGGAT

GTCGGCGTTGGGGACCGGCAGCACACCGCCGCCCCCGAAATGAAGTGGCGGCCCGTCCGCG

GCGACCTCTGCGTAGTACTCCAACTCGCACCGGGAACCCGACGTGGCCACGCCGTAAAACG

CCCAACTCTGAACGTTGACCTCGGATCAGGTAGGAATACCCGCTGAACTTAA

So sánh trình tự thu được của chủng nấm Nhộng trùng thảo bằng công cụ BLAST của NCBI cho thấy mức độ tương đồng về trình tự nucleotide với loài Cordyceps militaris là 99% - 100% (Hình 2, Hình 3). 

   

Hình 2. So sánh trình tự ITS-rDNA chủng nấm Nhộng trùng thảo trên GenBank

 

Hình 3. Mối quan hệ họ hàng của chủng nấm Cm với các loài/thứ trong cùng chi lấy trên Genbank trên cơ sở phân tích trình tự nucleotide vùng gen ITS-rDNA

Kết quả giám định ITS-rDNA của chủng nấm Nhộng trùng thảo nhập nội so với GenBank là loài nấm Cordyceps militaris.   

3.3. Nuôi trồng ra quả thể

  • Trên môi trường nhộng tằm, sau khoảng 7 – 9 ngày hệ sợi nấm lan kín cơ chất, sau 55 – 60  ngày xuất hiện mầm quả thể, sau 90 – 95 ngày thu quả thể; chiều dài quả thể đạt khoảng 20 – 40mm; đường kính quả thể 3 – 6mm; năng suất sinh học ≈ 35%.

     

     

     

    Hình 4. Quả thể nấm Cordyceps militaris nuôi trồng trên nhộng tằm

     

  • Trên môi trường gạo lứt, sau khoảng 5 – 7 ngày hệ sợi nấm lan kín cơ chất, sau 17 – 20  ngày xuất hiện mầm quả thể, sau 55 – 60 ngày thu quả thể; chiều dài quả thể đạt khoảng 30 – 60mm; đường kính quả thể 2 – 5mm; năng suất sinh học ≈ 49%.

 

 

 

                                Hình 5. Quả thể nấm Cordyceps militaris nuôi trồng trên gạo lứt

3.4. Phân tích một số thành phần dinh dưỡng, hoạt chất

Kết quả phân tích tại Viện Thực phẩm chức năng:

Bảng 5. Thành phần dinh dưỡng, hoạt chất nấm Nhộng trùng thảo nuôi trồng

TT

Chỉ tiêu phân tích

 

Kết quả

 

I

Thành phần dinh dưỡng cơ bản, %

Công bố của Xiaoli

L. et al., 2014

Nhộng trùng thảo trên nhộng tằm

Nhộng trùng thảo trên gạo lức

1

Protein tổng số

25,37

41,8

29,4

2

Lipide tổng số

3,35

21,0

5,5

3

Polysaccharide

4,32

4,96

4,48

II

Aminoacid, mg/g

 

 

 

1

Threonine

13,8

13,37

12,93

2

Serine

12,0

13,24

12,76

3

Glycine

13,0

19,60

11,96

4

Leucine

17,1

20,94

27,69

5

Tyrosine

20,6

9,53

10,09

6

Phenylalanine

21,4

11,72

7,21

7

Lysine

12,6

21,96

14,49

8

Histidine

3,0

13,16

7,39

9

Arginine

13,6

15,46

12,22

10

Methionine

8,2

0,0382

0,0547

11

Valine

23,5

10,18

8,97

12

Alanine

16,0

13,62

16,55

13

Proline

13,4

1,73

1,82

14

Aspartic acid

25,2

24,53

15,94

15

Glutamic acid

35,6

25,94

28,98

IV

Chất có hoạt tính sinh học, mg/g

 

 

 

1

Cordycepin

1,72

4,80

2,92

2

Adenosine

0,96

0,08

0,70

Qua Bảng 5 cho thấy hàm lượng polysaccharide, hàm lượng 15 loại aminoacide của nấm Cordyceps militaris trên nhộng tằm và gạo lứt tương đương với công bố của Xiaoli L. et al., 2014; đặc biệt hàm lượng cordycepin  trên nhộng tằm cao hơn ≈ 2,8 lần và trên gạo lứt cao hơn ≈ 1,7 lần so với công bố của Xiaoli L.et al., 2014. [5, 6]

4. KẾT LUẬN VÀ ĐỀ NGHỊ

4.1. Kết luận

Đã xác định được nguồn carbon là glucose; nguồn nitơ hữu cơ là peptone; ngưỡng nhiệt độ 20 – 25oC; pH = 6,0 là thích hợp cho phát triển hệ sợi nấm Nhộng trùng thảo.

Đã nuôi trồng thành công nấm Nhộng trùng thảo trên nhộng tằm có bổ sung 1% bột gạo lứt; gạo lứt có bổ sung 10% bột nhộng tằm với một số thành phần dinh dưỡng và hoạt chất tương đương với công bố của Xiaoli L.et al., 2014.

4.2. Đề nghị

Tiếp tục nghiên cứu hoàn thiện quy trình nuôi trồng nấm Cordyceps militaris tối ưu trên môi trường thích hợp, nâng cao hoạt chất.

Nghiên cứu quy trình chế biến sản phẩm Nhộng trùng thảo sau thu hoạch.

  Hướng đến việc chuyển giao, nhân rộng sản xuất nhằm chăm sóc sức khỏe cộng đồng, cung cấp nguồn dược liệu phục vụ chế biến thực phẩm chức năng, giảm giá bán sản phẩm hợp lý sao cho đến được với người tiêu dùng. Vì vậy, Trung tâm Ứng dụng khoa học và công nghệ Lâm Đồng đã phối hợp với Công ty Đông trùng hạ thảo Châu Á đề xuất dự án cấp Nhà nước thuộc Chương trình nông thôn miền núi giai đoạn 2016 – 2025, hiện đang hoàn thiện thủ tục để triển khai thực hiện, trong đó Trung tâm là đơn vị chuyển giao công nghệ; dự án được triển khai sẽ giúp phát triển nguồn dược liệu quý; phục vụ tiêu dùng, chế biến thực phẩm chức năng, góp phần phát triển kinh tế-xã hội tại địa phương.

 

TÀI LIỆU THAM KHẢO

  1. Amit K. S. và Anand S. – In vitro isolation and influence of nutritional condition on the mycelial growth of entomopathogenic and medicinal fungus Cordyceps militaris. Plant pathology Jounal 5 (3) (2006) 315 – 321.
  2. Clarkson J. M. and Charnley A. K. - New insights into the mechanisms of fungal pathogenesis in insects. Trends in Microbiology 4 (1996) 197 – 204. 
  3. Liang Z. Q. et al. - The genus Cordyceps and its allies the Kuankoushui Reserve in Guizhou III. Fungal Diversity 14 (2003) 95 – 101.
  4. Phạm Văn Tất - Ứng dụng tin học trong sinh học. Giáo trình dùng cho sinh viên ngành Sinh học, Trường Đại học Đà Lạt (2007).
  5. Ting-chi W. et al. - Optimization of Solid-state Fermentation for Fruiting Body Growth and Cordycepin Production by Cordyceps militaris. Chiang Mai J. Sci. 41 (4)  (2014) 858-872.
  6. Xiaoli L. et al. – Composition and antitumor activity of the mycelia and fruiting bodies of Cordyceps militaris. Journal of Food and Nutrition Research 2 (2) (2014) 74-79.

                                                           

Copyright © 2016 Trung Tâm Ứng Dụng Khoa Học và Công Nghệ Lâm Đồng (Lamdong Center for Application of Science and Technology)

Địa chỉ: 35 Trần Hưng Đạo, Phường 10, TP. Đà Lạt, Lâm Đồng
Điện thoại: 02633833155 - Fax: 02633833155 - Email: casti@dalat.gov.vn